BIOTECH100
A Resource Guide to Investing in Biotechnology
Directory - Encyclopedia - Stock Index - Pipeline Drugs 

Biotechnology Encyclopedia

Telomere

A telomere is a region of highly repetitive DNA at the end of a chromosome, which functions as an aglet. Every time linear eukaryotic chromosomes are replicated, the DNA polymerase complex stops several hundred bases before the end; if it were not for telomeres, this would quickly result in the loss of useful genetic information. In prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination at. Only eukaryotes possess or require telomeres.

Telomeres are extended by telomerases, specialized reverse transcriptases that are involved in synthesis of telomeres in most organisms. Telomerases are very interesting DNA polymerases in that they carry an RNA template for the telomere sequence within them.

In humans, the telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. These theories remain relatively controversial at this time.

If telomeres become too short, they will uncap. The cell will detect this as DNA damage and will enter cellular senescence (growth arrest). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Techniques to extend telomeres are useful for tissue engineering, because they permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through gene therapy. They reason that this would extend human life. So far these ideas have not been proven.

In 2003, scientists observed that the telomeres of the long-lived bird species Leach's storm petrel (Oceanodroma leucorhoa) seem to lengthen with age. This is considered the first known instance of such behaviour of telomeres.

A mechanism that limited cellular divisions was first noticed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Liz Blackburn at the University of California - San Fransisco. In 1998, Geron Corp. developed techniques for extending telomeres, and proved that they prevented cellular senescence.


Some known telomere sequences
GroupOrganismTelomeric repeat (5' to 3' toward the end)
VertebratesHuman, mouse, XenopusTTAGGG
Filamentous fungiiNeurospora crassaTTAGGG
Slime mouldsPhysarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastid protozoaTrypanosoma, CrithidiaTTAGGG
Ciliate protozoaTetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexan protozoaPlasmodiumTTAGGG(T/C)
Higher plantsArabidopsis thalianaTTTAGGG
Green algaeChlamydomonasTTTTAGGG
InsectsBombyx moriTTAGG
RoundwormsAscaris lumbricoidesTTAGGC
Fission yeastsSchizosaccharomyces pombeTTAC(A)(C)G(1-8)
Budding yeastsSaccharomyces cerevisiae

Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis

TGTGGGTGTGGTG (from RNA template)

or G(2-3)(TG)(1-6)T (consensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT


External links

 
Biotech100 Index
What are the Requirements to be listed in the Biotech100 Index?
 Biotech100 list of companies
Pipeline drugs for the Biotech100


Clinical Trials
What is a Clinical Trial?
Phase I ,-- Phase II, -- PhaseIII
What is Randomized Control?
 What is a Double Blind Experiment?
What is the role of the FDA?


Investing in Stocks
Small Cap Stocks
Stocks and Bonds
Biotech100 Index


Sponsored Links


Careers and Employment
Biotechnology and Pharmaceutical
What are the Fastest Growing Careers?

Key Biotech Terms


Google
 
Web www.biotech100.com
SEARCH THE BIOTECH100 WEBSITE
  
     

 
All text is available under the terms of the GNU Free Documentation License (see Copyrights for details). Disclaimers. Wikipedia is powered by MediaWiki, an open source wiki engine..
 


Copyright 2005 BIOTECH100.COM. All rights reserved.

email: info@biotech100.com